Family: Chaetodontidae
BOLD dataSampling location: | Atlantic Ocean off Angola, Angola basin, continental shelf, 07° 18' S / 12° 42' E, depth: 42-42 m, 10:00 - 11:40 am |
Sampling country: | Angola |
Sampling latitude: | -7.300000 ° |
Sampling longitude: | 12.700000 ° |
Sampling date: | 23-03-2003 |
>org.aquagene|B333_16S|16S ribosomal RNA|Chaetodon robustus
CGCCTCTTGCAAATTAATGAATAGGAGGTCCCGCCTGCCCGGTGACTATATGTTTAACAGCCGCGGTATTCTAACCGTGCGAAGGTAGCGTAATCACTTGTCTTTTAAATGAGGACCTGTATGAATGGCATAACGAGGGCCTAACTGTCTCCTCTTTTAAGTCAATGAAATTGATCTTCCCGTGCAGAAGCGGGAATAATAACATAAGACGAGAAGACCCTATGGAGCTTTAGACAAAAGCAGATTATGTTTAGAACCCTTAAATAAGAGGCCGAACTCGATATTTACTGCCTCGATGTCTTTGGTTGGGGTGACCGCGGCGAAATAAATATCCTCCGTGAAGAAAGAGGGTTCCTCCCTTCAAATCAAGAGCTCCCGCTCAAACGAATAGAATATCTAACTAAACAAGATCCGGCAATGCCGATCAACGGACCGAGTTACCCTAGGGATAACAGCGCAATCCCCTTTTAGAGCCCGTATCAACAAGGGGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGCGCAACCGCTATTAAGGGTTCGTTTGTTCAACGATTAAAGTCCT
[1] Prof. Dr. Reinhold Hanel
A genetic database collaboration developed by the Thünen Institute of Fisheries Ecology together with the Max Rubner-Institute - Department of Safety and Quality of Milk and Fish Products and Impetus Bioscience.
Funded by the German Federal Ministry of Food and Agriculture.
Sample collection performed by the Thünen Institute of Fisheries Ecology in cooperation with the University Mohammed V-Agdal (Morocco), the Instituto Nacional de Desenvolvimento das Pescas (Cape Verde), the National Agricultural Research Institute (The Gambia) and the EAF-Nansen Project.
Funded by the Moroccan Ministry of Higher Education, Scientific Research and Formation of Cadres and the German Federal Ministry of Education and Research.
// TODO: These are the details for the Reinhold Hanel portrait ...
Johann Heinrich von Thünen Institute
Institute of Fisheries Ecology
Herwigstraße 31, 27572 Bremerhaven, Germany
Phone:
+49 471 94460 200
Fax: +49 471 94460 199
Email:
aquagene@thuenen.de
Headquarter
Johann Heinrich von Thünen Institute
Federal Research Institute for Rural Areas, Forestry and Fisheries
Bundesallee 50, 38116 Braunschweig, Germany
Phone:
+49 531 596 1218
Fax: +49 531 596 1099
Email:
info@thuenen.de