A video teaser

// TODO: These are the details for the video teaser ...

AquaGene

The curated genetic reference database for fish species
Allowing an unambiguous determination of fisheries products

Species: Acanthurus xanthopterus

Family: Acanthuridae

BOLD data

Samples

Sampling location: Pointe Aux Sel
Sampling country: Seychelles
Sampling date: 05-02-2020
No map available
FASTA sequences
>org.aquagene|S070_COI|Cytochrome c oxidase subunit I|Acanthurus xanthopterus
CCTTTATTTAGTATTCGGTGCTTGAGCTGGAATAGTAGGAACGGCTCTGAGCCTCCTAATCCGAGCAGAATTAAGCCAACCAGGCGCCCTCTTAGGGGATGACCAAATTTATAATGTAATTGTTACAGCACACGCGTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGGTTCGGAAACTGATTAATTCCACTAATGATTGGAGCCCCTGATATAGCATTCCCACGAATGAACAATATGAGTTTTTGACTACTACCCCCATCTTTCCTACTCTTACTTGCATCCTCTGCAGTAGAATCCGGTGCTGGTACTGGATGAACAGTCTACCCTCCTCTAGCTGGTAACCTTGCACATGCAGGAGCATCCGTAGACCTAACTATTTTCTCCCTTCACCTCGCAGGAATTTCCTCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATAAAACCTCCTGCTACTTCTCAATATCAAACCCCTTTATTTGTATGAGCAGTATTAATTACTGCCGTCTTACTGCTTCTTTCACTTCCTGTTCTTGCTGCTGGTATTACAATATTACTCACAGACCGAAACCTAAATACCACTTTCTTTGACCCGG
Images
Image S070-1 of sample S070 (species: Acanthurus xanthopterus) / © © Johann Heinrich von Thünen Institute
[1]
Details for image 1

© Johann Heinrich von Thünen Institute

Image S070-2 of sample S070 (species: Acanthurus xanthopterus) / © © Johann Heinrich von Thünen Institute
[2]
Details for image 2

© Johann Heinrich von Thünen Institute

Image S070-3 of sample S070 (species: Acanthurus xanthopterus) / © © Johann Heinrich von Thünen Institute
[3]
Details for image 3

© Johann Heinrich von Thünen Institute

Image S070-4 of sample S070 (species: Acanthurus xanthopterus) / © © Johann Heinrich von Thünen Institute
[4]
Details for image 4

© Johann Heinrich von Thünen Institute

Image S070-5 of sample S070 (species: Acanthurus xanthopterus) / © © Johann Heinrich von Thünen Institute
[5]
Details for image 5

© Johann Heinrich von Thünen Institute

Image S070-6 of sample S070 (species: Acanthurus xanthopterus) / © © Johann Heinrich von Thünen Institute
[6]
Details for image 6

© Johann Heinrich von Thünen Institute

Image S070-7 of sample S070 (species: Acanthurus xanthopterus) / © © Johann Heinrich von Thünen Institute
[7]
Details for image 7

© Johann Heinrich von Thünen Institute

Image S070-8 of sample S070 (species: Acanthurus xanthopterus) / © © Johann Heinrich von Thünen Institute
[8]
Details for image 8

© Johann Heinrich von Thünen Institute

Copyrights:

[1] © Johann Heinrich von Thünen Institute; [2] © Johann Heinrich von Thünen Institute; [3] © Johann Heinrich von Thünen Institute; [4] © Johann Heinrich von Thünen Institute; [5] © Johann Heinrich von Thünen Institute; [6] © Johann Heinrich von Thünen Institute; [7] © Johann Heinrich von Thünen Institute; [8] © Johann Heinrich von Thünen Institute

AquaGene

A genetic database collaboration developed by the Thünen Institute of Fisheries Ecology together with the Max Rubner-Institute - Department of Safety and Quality of Milk and Fish Products and Impetus Bioscience.

Funded by the German Federal Ministry of Food and Agriculture.

Sample collection performed by the Thünen Institute of Fisheries Ecology in cooperation with the University Mohammed V-Agdal (Morocco), the Instituto Nacional de Desenvolvimento das Pescas (Cape Verde), the National Agricultural Research Institute (The Gambia) and the EAF-Nansen Project.

Funded by the Moroccan Ministry of Higher Education, Scientific Research and Formation of Cadres and the German Federal Ministry of Education and Research.

Contact

Reinhold Hanel (portrait)
Reinhold Hanel portrait

// TODO: These are the details for the Reinhold Hanel portrait ...

Responsible for the content/editorial:
Prof. Dr. Reinhold Hanel

Johann Heinrich von Thünen Institute

Institute of Fisheries Ecology
Herwigstraße 31, 27572 Bremerhaven, Germany
Phone: +49 471 94460 200
Fax: +49 471 94460 199
Email: aquagene@thuenen.de

Headquarter
Johann Heinrich von Thünen Institute
Federal Research Institute for Rural Areas, Forestry and Fisheries
Bundesallee 50, 38116 Braunschweig, Germany
Phone: +49 531 596 1218
Fax: +49 531 596 1099
Email: info@thuenen.de

© 2023 Johann Heinrich von Thünen Institute